Prova Discursiva

A) 5' CUUAGCCUAGUGACGGUAGUUACCGUCGAGAUCGGAUUCAUCAA 3'. B) mRNA a CUU-GAC-GGU-CAU-CAA. C) mRNA b CUU-GAC-GGU-CGA.

PADRÃO DE RESPOSTA – PROVA DISCURSIVA – BIOLOGIA 1º PROCESSO SELETIVO UNIFICADO 2019 – FACULDADE FAMINAS-BH E CENTRO UNIVERSITÁRIO UNIFAMINAS MURIAÉ CURSO: MEDICINA

QUESTÃO 01 A) Interação gênica do tipo Epistasia Dominante. B) P

IiCc x iicc. F1 Probabilidades 1/4 1/4 1/4 1/4

Genótipo IiCc Iicc iicc iiCc

Fenótipo Branco Branco Branco Colorido

Branco: ¾ Colorido: ¼

Fonte: 1. SILVA JÚNIOR, César da; SASSON, Sezar; CALDINI JÚNIOR, Nelson. Biologia – Ensino Médio. 12ª. ed. São Paulo: Editora Saraiva, v. 3, 2017. p. 87 – 91. TABUA DE CORREÇÃO – 5,0 pontos  Interação gênica do tipo Epistasia Dominante – Valor: 1,00 ponto  P IiCc x iicc – Valor: 4,00 pontos

QUESTÃO 02 A) 5’ CUUAGCCUAGUGACGGUAGUUACCGUCGAGAUCGGAUUCAUCAA 3’. B) mRNA a CUU-GAC-GGU-CAU-CAA C) mRNA b CUU-GAC-GGU-CGA D) PROTEÍNA a: Leucina – Ac. Aspártico – Glicina – Histidina – Glutamina PROTEÍNA b: Leucina – Ac. Aspártico – Glicina – Arginina Fontes:  SILVA JÚNIOR, César da; SASSON, Sezar; CALDINI JÚNIOR, Nelson. Biologia – Ensino Médio. 12ª.ed. São Paulo: Editora Saraiva, v. 1, 2017. p. 42-43.  AMABIS, José Mariano; MARTHO, Gilberto Rodrigues. Biologia Moderna. V.3, 1ª. Ed. São Paulo: Moderna, 2016. 352p. Versão do Professor. p. 78-79. TABUA DE CORREÇÃO – 5,0 pontos Interpretação do enunciado, conhecimentos de síntese proteica e suas etapas: transcrição e tradução – Valor: 5,00 pontos

Recommend Docs
<span ><span >26 de ago de 1989 - Luiz Carlos Dadalto <em>Filho. 3. 6. 9. 17/07/1985 ... Agostino Cremonini <em>Filho. 3. 4. 7. 16/02/1990 ... <em>Daniel Nascimento Duarte. 3. 3. 6. 06/09/1986.

<span >preco_normal: FLOAT imagem: VARCHAR(255) cupom id: INTEGER [ <em>PK ] codigo: VARCHAR(20) desconto: FLOAT validade: DATE usuario id: INTEGER [ <em>PK ].